|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Archive Cloning Data Access Note: The Blattner lab is closed; strains, clones, and vectors from its collection are no longer available. Information about their construction continues to be made available for those who obtained the clones from us in the past. The identities of all cloned inserts have been confirmed by end-sequencing. Some, but not all, of the clones were completely spanned by this end-sequencing. We would appreciate feedback from anyone who discovers evidence of sequence differences from that of the published MG1655 genome -- please email ecoli@genome.wisc.edu We constructed an ORF clone set in Invitrogens Gateway® entry vector, pDONR221 [sequence], allowing clones to be easily transferred to a series of compatible expression vectors using recombination-based cloning (Hartley, et al., 2000). Previously characterized individual full-length ORF fragments were adapted for the system using PCR to add attB1 and attB2 sequences to the 5' and 3' termini of each ORF, respectively. The 5' primer also introduced a Shine-Dalgarno site 11 bp upstream of the translational start codon. The primers used to create the Gateway clones are shown below: AttB1-F (52-mer) 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATTGCTCTTCCATG 3' AttB2-R (51-mer) 5' GGGGACCACTTTGTACAAGAAAGCTGGGTAGCGGCCGCTTGCTCTTCGTTA 3' KEY: attB sites S/D site SapI sites GCTCTTCNNNN Start & stop codons The retrofitted fragments were directionally cloned into the attP-containing pDONR221 using the commercially available lambda site-specific recombinase (BP Clonase®, Invitrogen). Recombinant clones were isolated as KanR ccdB- transformants of an F- recipient strain and verified by end sequencing. The sequence and map of any clone can be generated from the pDONR221 sequence, parts of the primers, and the MG1655 sequence annotated for the gene in question. The ORFs can be moved to a series of destination vectors for expression as either transcriptional or translational fusions by a second recombination reaction using LR Clonase (Invitrogen). The efficiency of these reactions allows the entire clone set or any subset to be systematically shuttled to multiple expression vectors. The set also contains sites for the Class II restriction enzyme, SapI, positioned so that each ORF can be precisely excised with 3 bp overhangs at both ends corresponding to the start and stop codons. This allows transfer of any ORF to a SapI adapted expression vector, such as pJG1 and pJG2 (see below). These plasmids enable regulated expression of the cloned ORF from the T7 promoter, producing either native protein or a 6xHIS fusion. The ORFs were Pfu-amplified using the gene-specific primers (E.
coli ORFmers, Sigma-Genosys) and the products were blunt-ligated
into the EcoRV
site of pOCUS-2 [sequence]
(Novagen). Each ORF-specific PCR primer contains a 13 nt constant region at its 5' end (TTGCTCTTCCATG for amino primers and TTGCTCTTCGTTA for carboxy primers). The sequence GCTCTTC is recognized by the restriction enzyme SapI which cuts in the 4 nt adjacent to the recognition site. Since PCR fragments are blunt cloned into the archive plasmid pOCUS-2, it is possible to cut archive clones with SapI releasing a ORF-containing fragment with 3' overhangs that correspond to the start and stop codons of the ORF. Some E. coli ORFs have internal SapI sites, but only a handful generate ATG or TTA overhangs. SapI fragments from archive clones can easily be ligated into vector DNA prepared using an appropriate stuffer fragment. An example of a SapI stuffer in an expression vector is shown in the figure below. We used pET29a(+) [sequence] DNA (Novagen) and removed a SapI site from the vector and introduced a SapI stuffer fragment into the multi-cloning site. The vector is prepared to receive inserts from archive clones by cutting with SapI to remove the stuffer fragment and create sticky ends complementary to those coming from the archived ORF. DNA from a gene-specific archive clone is mixed with the expression vector DNA in the presence of SapI and ligase. SapI resistant recombinant plasmids are easily obtained since the archive plasmid and uncut expression plasmid are both cut by SapI. We have constructed two expression plasmids with SapI stuffer fragments. The pET-29a(+)-based plasmid diagrammed below (plasmid name pJG1) will produce transcripts that should permit expression of full-length native proteins using T7 expression system (Novagen). A second plasmid (pJG2) is the same as pJG1 but is designed to incorporate a 6xHIS tag at the amino-terminus of the expressed protein. This diagram shows the general design of our gene-specific PCR primers and the SapI-based subcloning strategy. ORFs are PCR amplified to generate blunt-ended fragments with SapI recognition sites near their ends. These products are blunt-cloned into pOCUS-2 (not shown). Cutting with SapI releases a fragment with overhangs corresponding to the ORF start and stop. These fragments can be ligated into an appropriate expression vector containing a SapI stuffer fragment. The drawing below shows the stuffer sequence from the pJG1 expression vector.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|
| home
| contact us |
|
|
©
2002-2024 UW E. coli Genome Project
|